Review



p7056 phage p cmvt n ha gawcpt1a  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc p7056 phage p cmvt n ha gawcpt1a
    P7056 Phage P Cmvt N Ha Gawcpt1a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p7056 phage p cmvt n ha gawcpt1a/product/Addgene inc
    Average 93 stars, based on 3 article reviews
    p7056 phage p cmvt n ha gawcpt1a - by Bioz Stars, 2026-03
    93/100 stars

    Images



    Similar Products

    effector  (ATCC)
    91
    ATCC effector
    Effector, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/effector/product/ATCC
    Average 91 stars, based on 1 article reviews
    effector - by Bioz Stars, 2026-03
    91/100 stars
    		  Buy from Supplier
    biomers n a recombinant dna λ phage dna new england biolabs  (New England Biolabs)
    99
    New England Biolabs biomers n a recombinant dna λ phage dna new england biolabs
    Biomers N A Recombinant Dna λ Phage Dna New England Biolabs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biomers n a recombinant dna λ phage dna new england biolabs/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    biomers n a recombinant dna λ phage dna new england biolabs - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    p7056 phage p cmvt n ha gawcpt1a  (Addgene inc)
    93
    Addgene inc p7056 phage p cmvt n ha gawcpt1a
    P7056 Phage P Cmvt N Ha Gawcpt1a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p7056 phage p cmvt n ha gawcpt1a/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    p7056 phage p cmvt n ha gawcpt1a - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    laval her 44 φx174 phage virginia tech n a φ6 phage virginia tech n a λ phage atcc 23724 b2 chemicals  (ATCC)
    94
    ATCC laval her 44 φx174 phage virginia tech n a φ6 phage virginia tech n a λ phage atcc 23724 b2 chemicals
    Laval Her 44 φx174 Phage Virginia Tech N A φ6 Phage Virginia Tech N A λ Phage Atcc 23724 B2 Chemicals, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/laval her 44 φx174 phage virginia tech n a φ6 phage virginia tech n a λ phage atcc 23724 b2 chemicals/product/ATCC
    Average 94 stars, based on 1 article reviews
    laval her 44 φx174 phage virginia tech n a φ6 phage virginia tech n a λ phage atcc 23724 b2 chemicals - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    paper n a pmys gfp u6 bbsi  (Addgene inc)
    93
    Addgene inc paper n a pmys gfp u6 bbsi
    Paper N A Pmys Gfp U6 Bbsi, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/paper n a pmys gfp u6 bbsi/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    paper n a pmys gfp u6 bbsi - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    paper n a phage ef1al egfp addgene rrid addgene 126686 phage minicmv egfp  (Addgene inc)
    93
    Addgene inc paper n a phage ef1al egfp addgene rrid addgene 126686 phage minicmv egfp
    Paper N A Phage Ef1al Egfp Addgene Rrid Addgene 126686 Phage Minicmv Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/paper n a phage ef1al egfp addgene rrid addgene 126686 phage minicmv egfp/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    paper n a phage ef1al egfp addgene rrid addgene 126686 phage minicmv egfp - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    caaggagctgactgtcatctgg 30 thermofisher n a primer pxdn  (Addgene inc)
    88
    Addgene inc caaggagctgactgtcatctgg 30 thermofisher n a primer pxdn
    Caaggagctgactgtcatctgg 30 Thermofisher N A Primer Pxdn, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/caaggagctgactgtcatctgg 30 thermofisher n a primer pxdn/product/Addgene inc
    Average 88 stars, based on 1 article reviews
    caaggagctgactgtcatctgg 30 thermofisher n a primer pxdn - by Bioz Stars, 2026-03
    88/100 stars
    		  Buy from Supplier

    Image Search Results